RT-PCRscreening of collected shrimp samplesTotalRNAs were extracted from shrimp pleopods using TriReagent (Qiagen), followingthe manufacturer’s instructions. Purityof extracts was evaluated by the ratio between the readings at A260/280 nm.The extract was then stored at -80°C. A quantity of 100 ng of the total RNAswere processed for RT-PCR. Theextracted RNA was determined for the presence of LSNV by using SuperScriptÔIIIOne-StepRT-PCR system with Platinum® Taq DNA polymerase Kit (Invitrogen,Carlsbad, CA). The RT-PCR reagent contained 2x Reaction Mix, template RNA,sense primer (10µM), anti-sense primer (10µM) and SuperScriptÔIIIRT/Platinum® Taq Mix. The RT-PCR reagent, 11.
5?µl, was pipetted intoeach 0.5 ml reaction tube with proper label. 1 µl of the extracted RNA sample,DEPC-water (for negative control) and positive control was added into eachreaction mixture and amplification process was carried out as follow: 50 °C, 30min for cDNA synthesis; 94 °C, 2 min for denaturation followed by PCRamplification, which starts at the same temperature for 15 sec fordenaturation; 55 °C, 30 sec for annealing; and 68 °C, 1 min for extension. Theamplification was carried out for 35 cycles, and ended by the last 68°C, 5 minfor final extension. Quantificationof MIH-1 and CHH-1 transcripts levels Specific primer for MIH-1and EF-1? were designed based on complete sequence of MIH-1(GenBank acc. no. AY496454), and a partial sequence of the control gene, theelongation favtor (EF-1?) (GenBank acc. no.
DQ021452); the expectedamplicon sizes were 172 and 140 bp, respectively (Namwong, 2009). Specificprimer for P. monodon CHH gene were designed based on a completesequence of CHH-1 (GenBank acc. no. AY346378,nt 183-391) by using Primer 3 software; andthe expected amplicon sizes was 199 bp. The specific primers were asfollow: MIH-1: F(5’catagacggcacttgtcgag 3′) and R (5′ cctgttggcagcctttagac 3′) CHH-1: F (5’ccagaagcctctcctgtgac 3′) and R (5′ acaactgggtgggttactgc 3′) EF-1?: F (5’gaactgctgaccaagatcgacagg 3′) andR (5´gagcatactgttggaaggtctcca 3´)The screening test of MIH-1,CHH-1 and EF-1? mRNA expression from total RNA was conducted byRT-PCR. Shrimp eyestalk was isolated as described in 2.1.
1, whereas RT-PCR wasdone as described in 4.2.1.2 by using the above primer. The PCR product wasthen analyzed by 1.2% ethidium bromide agarose gel electrophoresis. To checkthe sequence of CHH-1 after amplification, the PCR product was purified byQIAquick PCR purification kit (QIAGEN, Hilden, Germany) and the DNAconcentration determined by spectrophotometry with the absorption at OD260. Thepurified PCR product was then ligated to pGEM®-T easy vector system (Promega, Madison, WI) (Fig.
4.2). The mixture,10 ?L of total volume (1 ?L of 200 ng DNA fragment, 3 ?L of 50 ng pGEM®-T easyvector, 5 ?L of 2x ligation buffer, and 1 ?L of T4 DNA ligase) was incubated at4 °C overnight. The content was then transformed into the competent cells, E.coli XL1 blue. Briefly, 50 ?L of prepared competent cells (stored at -80°C) was added with the ligation mixture, incubated on ice, 30 min in themicrocentrifuge tube. The reaction tube was heated in the water bath at 42 °Cfor 2 min and placed on ice for 2 min.
The LB medium (10 g Bacto-Tryptone,(Difco 0123-01-1), 5 g Bacto-yeast extract (Difco 0127-05-3), 10 g NaCl, ddH2Oto 1 L), 500 ?L was added to the ligation tube, and mixed before incubated onthe shaker at 37 °C for 1 h. The transformed reaction of 200 ?L was plated onthe LB/amplicilin/X-gal plate (10 g Bacto-Tryptone (Difco 0123-01-1), 5 gBacto-yeast extract (Difco 0127-05-3), 10 g NaCl, 15 g Bacto-agar (Difco0140-01), ddH2O to 1 L) containing 100 ?g/ml ampicilin, and 80 ?g/ml X-gal. Theplate was incubated overnight, at 37 °C, for 16 h. PCR on colonies of bacteria,E. coli was conducted to analyze the transformants. PCR reaction 25 ?Ltotal volume consisting of 18 ?L ddH2O, 2.
5 ?L 10x buffer, 0.75 ?L MgCl2, 0. 5?L dNTP, 1 ?L sense primer, 1 ?L antisense primer, 0.
25 ?L Taq DNApolymerase (Invitrogen), and E. coli cells was done for 25 cycles(denaturation at 94 °C for 5 min 30 sec, annealing at 55 °C for 30 sec,extension at 72 °C for 30 sec, and terminating with final extension at 72 °Cfor 5 min) using primers, SP6 and T7 promoter. The products were separated on1.
2% agarose gel, and visualized with an ethidium bromide. Single colony wassubcloned in LB medium containing ampicilin overnight at 37 °C on shaker. Cellscontaining inserted plasmid DNA were then extracted using QIAGEN Plasmid MiniKit (QIAGEN, Hilden, Germany). PCR was done to confirm the insertion using genespecific primers before DNA sequencing. The sequences of a single colony werethen compared with the CHH-1 sequences using ClustalW (http://www.ebi.ac.uk/Tools/clustalw2/index.html).
